"What will it be?" asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Many of the jokes are contributions from our users. If you find anything offensive and against our policy please report it here with a link to the page. We will do everything to make this an enjoyable platform for everyone.