Help me finish my joke about this one diabetic's gangrenous foot...

So two guys go...

One says "I'll be right back don't do anything!" He's gone for maybe five...

Chinese Doctor

A Chinese Doctor can't find a job in a Hospital in the US, so he opens a...

We have a genetic...

Runs in our jeans.

As the trial...

but three hours pass and no word from the jury. So the judge calls the jury...

A DNA molecule...

"What will it be?" asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA...

A drunk was...

and he passed a nun wearing her habit. After passing her, he stopped dead in...

A women is...

The man desperately darted around the room looking for somewhere to hide....

Why did eve have...

She just wanted to make a little prophet...

There are two...

There are two things on earth that are universal: hydrogen and stupidity.

Exorcism

The other day a roommate asked if it was ok to have a priest come over and...